Haliotis kamtschatkana

Pinto abalone are sessile gastropods that exist in patchy distributions (Sloan and Breen 1988). Their preferred habitat is categorized as rocky-shore coastline. At its northern range limit, pinto abalone occur from the intertidal zone to at least 10–20 m depth (Cripps and Campbell 1998), although there are some reports of abalone found at 100 m. In its southern range limit, McLean (1966) described pinto abalone as strictly subtidal, but Cox (1962) claimed that large populations could be found in deeper waters.

Pinto abalone are herbivores of the intertidal zone, and are prey to a diverse range of predators. Early pinto abalone diet consists of phytoplankton, but at 5 mm (SL) they switch to macro-algae that ranges from minute forms to giant bull kelp (Kawamura et al. 1998). Abalone predators differ depending on the water depth in which they occur. In subtidal waters, their predators include asteroids (Pycnopodia and Astrometis), crabs, fish (Scorpaenichthys, Anarrhichthys, Myliobatis, and Semicossyphus), octopi, and sea otters (Enhydra lutris) (Sloan and Breen 1988, Hobday and Tegner 2000). In intertidal waters, birds, sea otters, and mink are the major predators (Day and Shepherd 1995). The eradication of the sea otter during the 19^th century led to the increased co-occurrence of sea urchins and abalone. Sea urchins out compete pinto abalone for food resources, which has resulted in "sea urchin barrens"—large areas with high sea urchin populations, no macroalgae and little or no abalone (Jamieson 2001). Nevertheless, sea urchins may provide some enhancement by maintaining encrusting coralline algae cover (Tegner and Levin 1982, McShane 1992) and by affording shelter under their spine canopy to small abalone (Tegner and Dayton 1987).

GGCTTAGTCGGAACTGCACTCAGTCTTTTAATTCGGGCCGAACTTGGCCAGCCAGGAGCACTCTTGGGGGAC---GACCAACTCTATAACGTAATTGTAACAGCCCACGCTTTCGTAATAATCTTCTTCCTAGTTATACCACTAATAATTGGAGGATTTGGAAACTGACTGGTCCCTTTAATATTAGGGGCACCAGACATAGCCTTTCCCCGACTAAATAACATAAGATTCTGACTCCTTCCGCCATCCTTAACCCTACTCCTAACATCGGGCGCTGTAGAAAGTGGAGCGGGGACAGGCTGAACAGTCTATCCTCCCCTCTCTAGTAACCTTGCCCACGCAGGAGCATCAGTAGACTTAGCAATTTTCTCCCTACACCTAGCCGGAATCTCATCAATTTTAGGGGCAGTAAACTTTATTACTACAGTAATAAATATACGTGTAAAAGCACAGCCTCTAGAACGAATGCCATTATTTGTTTGATCAGTAAAAATTACCGCCATCCTACTACTCCTATCACTACCTGTTCTAGCAGGTGCCATTACAATACTCCTAACCGACCGTAATTTC
-- end --

Red List Category

Red List Criteria

Version

2006

McDougall, P.T., Ploss, J. & Tuthill, J.

Geiger, D., Haaker, P. & Seddon, M.B. (Mollusc Red List Authority)

The global status of the pinto abalone Haliotis kamtschatkana Jonas, 1845 is assessed as EN A2abd based on an observed population size reduction of >50%. We report on declines of 89.7% and 41.4% observed in catch per unit effort (CPUE) for both the Alaskan and British Columbian fisheries respectively. These data are comparable to declines in population densities of 88.6% and 85.5%, as measured at index sites in two regions on the coast of British Columbia. Although the observed declines support a classification of CR A2a (an observed population size reduction of >80%), we judge that the historical elimination of a chief predator led to abnormally large pre-exploitation levels. Due to the observed declines, all commercial harvests of the pinto abalone were closed by the year 1996. Current population numbers are stable, but potential for further decline still exists due to incomplete knowledge, an increase in sea otter populations, and continued poaching.

Correction notice: the EN A2a assessment that appeared in the 2006 Red List was corrected to EN A2abd in 2007. Based on the information provided in the assessment, the >50% population declines are based on direct observation, an index of abundance (CPUE and site index data) and direct exploitation of the species.

Follow the link below for Tables 1 & 2, and Figures 2, 3 & 4.

Alaska and British Columbia are the only two regions where targeted commercial fisheries for pinto abalone ever existed. Data from these area consist of catch totals and CPUE values for both regions as well as index site densities from the coast of British Columbia. The percentage of the global population of pinto abalone present in British Columbia and Alaska is not known (Toole et al. 2002), however, NMFS (2004b) reported that the pinto distribution predominantly occurs in Alaska, British Columbia, and Washington. Nevertheless, significant populations of pinto abalone are absent south of San Juan, Orcas and Lopez Islands in Washington State (B. Sizemore, Department of Fish and Game, Olympia, WA, pers. comm). Furthermore, Rogers-Bennett et al. (2002) reported that pinto abalone are very rare in Northern California, accounting for only <1% of the total abalone population in that region. Due to the scarcity of pinto abalone south of Washington, and since the reported densities in Washington were below the suggested minimum viable density for abalone recruitment in 1996 (Table 1), we made the assumption that Alaska and British Columbia represent the core of the species distribution.

We estimated the generation time for pinto abalone at about 10 years. This estimate is potentially subjective due to the difficulties in aging and the uncertainties of the stock-recruitment relationships. Breen (1986) speculated that individual pinto abalone could live up to 50 years, but this was an estimate based on a single individual that measured 164 mm (SL). Growth curves suggest that the largest abalone live to be at least 13–15 years of age (Quayle 1971, Sloan and Breen 1988, Shepherd et al. 2000). Furthermore, due to the relationship of increased fecundity with increased size (see Campbell 1997), older abalone contribute more to the total reproductive output of the population than do younger abalone. Considering that reproductive age ranges from approximately 3–4 years old to 13–15 years old, we reached an estimate of 10 years of age for the purpose of this assessment. In order to satisfy the IUCN stipulation for declines observed “over the last 10 years or three generations, whichever is the longer” (IUCN 2001), this assessment would require data that extended back 30 years, to about 1974. This is approximately the time period that we used for the assessment, with some limitations due to the data.

Population in Alaska
Alaskan fishery CPUE data for the pinto abalone extend back to 1971. A sharp initial increase in both catch as well as CPUE in the early seventies (Fig. 2) was likely an artifact of a developing fishery (Breen 1986). We therefore decided to consider the decline in CPUE from the peak in 1979 to the close of the fishery in 1996. We analyzed the CPUE values against calendar year using a linear regression. The slope of the regression line indicates an observed decline in CPUE of 89.7% between 1979 and 1996 (Table 2).

The 89.7% decline in CPUE is the only measure of pinto abalone numbers in Alaska, since the region has no abalone index sites. Without index sites, and with the closure of the fishery in 1996, there is no way to determine the current status of Alaskan stocks of pinto abalone. We assume that the patterns in British Columbia reflect the post-closure Alaskan abalone populations as well.

Population in British Columbia
There are two types of data from the British Columbia portion of the range: fisheries-dependent and fisheries-independent. The fisheries-dependent data consist of catch and CPUE values that extending back to 1977. Complementing this are fisheries-independent data that consist of densities measured at survey sites throughout the central coast (Campbell et al. 1998) and the southeast region of the Queen Charlotte Islands (Campbell et al. 2000). Since the fisheries-independent data extend past the 1990 closure of the fishery, they provide a view of the current status of pinto abalone in British Columbia.

The decline observed in the CPUE data from the British Columbian fishery is less steep that that observed in the Alaskan fishery (Fig. 3). The CPUE values were analyzed against calendar year using a linear regression (Table 2), which demonstrated a 41.4% decline in CPUE between 1977 and 1990. The difference in the percentage decline in CPUE between Alaska and British Columbia is likely a result of different approaches in fisheries management. The initial response to the 1977 expansion in the British Columbia abalone fishery was to establish a limited entry fishery, where managers sought to limited effort (Muse 1998). Limiting the entry, and thus the number of divers in the fishery, served to offset the decreasing catch totals. This reduced the observed decline in CPUE; the opposite of what occurred in the Alaskan fishery where the rapid increase in diver participation in the early 1990s accelerated the decline in CPUE.

The site index surveys in the southeast Queen Charlotte Islands and in the central coast region demonstrate a much steeper decline in population numbers than do the CPUE data. There was an 88.6% decline between the 1979–80 density of 2.37 abalone/m² and the 2001 density of 0.27 abalone/m² in the central coast of British Columbia (Fig. 4, panel A). Furthermore, there was an 85.5% decline between the 1978 density of 2.75 abalone/m² and the average density of 0.40 abalone/m² in 1990, 1994, 1998, and 2002 in the Queen Charlotte Islands (Fig. 4, panel B). We averaged the densities in the last four surveys of the Queen Charlotte Islands because they represent an apparent levelling out of the decline. There has been no significant increase or decrease in densities observed in that area since the closing of the fishery in 1990 (Campbell et al. 2000).

The Queen Charlotte Islands index sites are considered accurate estimates of density levels in that region of the pinto abalone distribution. Campbell et al. (2000) reported no significant difference between the density recorded at index sites (0.49 abalone/m²) and the density recorded at other random sites (0.54 abalone/m²) in 1998. Furthermore, these density values are comparable to densities observed in other regions of British Columbia. In a study on Dallain Point and Higgins Pass (central coast of British Columbia), total densities were observed at 0.43 and 0.52 abalone/m², respectively (Cripps and Campbell 1998). Similarly, a survey of abalone populations at Stryker Island, Tribal Group Islands and Simonds Group Islands (also within the central coast of British Columbia) reported densities of 0.71, 0.55 and 0.59 abalone/m², respectively (Campbell and Cripps 1998). Although there are no data that allow for a temporal comparison, the general similarities in observed densities reinforce the findings from the two major studies charting the abalone decline.

It is important to note that although the above declines are steepest prior to the close of the fishery, and that the index sites indicate very little change over the past decade, there is a great deal of uncertainty involved. So much of pinto abalone biology remains unknown, and despite a number of possible suspects, the reason for the lack of recovery remains a mystery. With densities dangerously close to suggested recruitment thresholds, it is quite possible that the decline, although lessened by the closure of the fishery, may not be recoverable.

CPUE versus Site Index Densities
Abalone are vulnerable to serial depletion because they are sessile invertebrates with a moderate ability to aggregate (McShane 1998, Karpov et al. 2000). This characteristic of abalone ecology results in a potential bias when using CPUE data to demonstrate trends in abundance (McShane 1998). CPUE can remain relatively steady despite declining abundance. Due to this bias, the decline in CPUE observed in the Alaskan fishery is possibly an underestimate of the actual drop in abalone numbers—although management decision to leave effort in the fishery unrestricted certainly contributed to increasing the slope of declining CPUE. On the other hand, British Columbian managers successfully limited entry into the latter portion of the fishery, which possibly resulted in the slower observed decline in CPUE. Nonetheless, the British Columbia fishery CPUE trend is also likely an underestimate of the actual decline due to the same bias from harvesting techniques. With the uncertainty attached to both CPUE measures, the best estimate is likely to be the most direct measure available. Since the index sites in British Columbia are direct measurements of abalone density, they likely offer the clearest view of pinto abalone numbers. This view is of a species reduced to dangerously low levels, although levels that appear to be sufficient for persistence given the current conditions.

Stable

Follow the link below for figure 5.

Human Exploitation
Poaching of pinto abalone is a lucrative enterprise and is likely placing continued stress on the remaining abalone populations (Campbell 1997, Muse 1998, Wallace 1999, Jamieson 2001). This is unsurprising given that the value per diver hour in the British Columbia fishery was over CAD 600 prior to its closure, and continued upwards due to an ever-expanding market demand in Asia (Muse 1998). Wallace (1999) reported that pinto abalone meat could fetch up to CAD 100/kg on the black market in southern British Columbia. Furthermore, recreational divers and First Nations harvesters may also be responsible for a significant amount of illegal abalone collection (Tegner 2000). The combination of this high black-market value and the enforcement problems resulting from a large and uninhabited coastline suggest a major threat to abalone recovery (Toole et al. 2002).

In support of the aforementioned threats, sample data on the size distribution of a seizure of more than 6,700 pinto abalone in British Columbia suggests that poachers are collecting mature abalone with no regard for the legal size limit (Campbell 2000). So in effect, poachers are taking everything that they can find. Maintaining a viable density of reproductive individuals is crucial for recruitment levels and for the survivability of the stock. Extensive poaching effort risks extirpating abalone from local areas, thereby jeopardizing the recovery of the entire population.

Illegal harvest of pinto abalone is likely to continue to pose a threat to the recovery of the species. The large and mostly uninhabited coastline is a serious hindrance to enforcement efforts (Toole et al. 2002). Furthermore, the extraordinarily high unit value of pinto abalone makes poaching a very lucrative enterprise (Campbell 2000). The removal of large numbers of mature individuals drastically threatens the reproductive potential of an already depressed population (Toole et al. 2002). Poachers also represent a major concern to the establishment of protected areas and no-take zones. Such areas are easily flagged as targets for illegal exploitation, which compromises their value as refugia (Tegner 2000).

Recruitment failure
There is both empirical and theoretical evidence to suggest that abalone are susceptible to recruitment failure at reduced densities (Prince et al. 1988, Shepherd and Partington 1995, Woodby et al. 2000, Jamieson 2001). Shepherd and Partington (1995) reported a minimum recruitment density of 0.15 recruits/m², which renders the population highly susceptible to recruitment over-fishing. Furthermore, there is considerable intra- and inter-annual variation in recruitment and in the production of gametes in individuals (McShane 1998). Reproductive success is also dependent upon the distance between spawners, the number of eggs and sperm released, the speed of water currents as well as other factors (Babcock and Keesing 1999). Because harvesters of abalone tended and still tend to remove all available individuals from each site that they visit, it is expected that the resulting smaller local populations have been, and are currently, at risk of experiencing recruitment failure.

Predation by Sea Otters
Sea otters are effective predators of abalone (Wendell 1994, Watson 2000). They currently overlap with pinto abalone in only the northernmost reaches of the pinto distribution (Fig. 5, panel B) (Watson 2000, Estes et al. 2001). Due to this partial overlap, it is doubtful that sea otters are responsible for the observed decline in abalone populations over the last few decades. Nevertheless, sea otter numbers are increasing as a result of strong conservation efforts (Estes et al. 2001). Where pinto abalone and sea otters coexist, sea otters are thought to consume abalone in significant numbers (Watson 2000). A study investigating the impact of sea otters on H. rufescens (red abalone) in California reported that the effects of predators on abalone abundance were greater than the effects of recreational harvesting (Fanshawe et al. 2003).

The range of the sea otter historically encompassed the entire range of the pinto abalone (Fig. 5, panel A). Over-exploitation throughout the Western Pacific rim at the end of the 18^th century led to the extirpation of the sea otter in British Columbia, Washington, most of California, and much of Alaska (Wendell 1994, Watson 2000, Estes et al. 2001). Following translocations in California, and reintroductions in the 1970s in British Columbia, Washington, Oregon, and Southeast Alaska, the sea otter is rapidly re-establishing itself (Fig. 5, panel B) (Watson 2000, Estes et al. 2001). This expansion will likely result in a decrease in pinto abalone populations (Watson 2000). In one location along the California coast, the reintroduction of sea otters to the region resulted in a 93% decline in local red abalone populations (Wendell 1994). Another study reported sea otter predation on red abalone had a larger effect on abalone densities than did recreational harvesting (Fanshawe et al. 2003).

Habitat and Ecological Shifts
With the localized nature of the abalone stock recruitment relations, pinto populations are very susceptible to development and habitat destruction (Toole et al. 2002). Furthermore, ecological shifts due to increased urchin densities may also play a factor in current pinto abalone recovery. Abalone growth may be restricted by the presence of sea urchins when food supplies are limited (Tegner and Levin 1982). Researchers in British Columbia monitoring the decline of pinto abalone at index sites, however, have not indicated that urchins are an immediate threat (Campbell et al. 1998, Cripps and Campbell 1998).

Disease
The large and continuing decline of H. cracherodii (black abalone) in California (Petrovic et al. 2001) is partly a result of Withering Syndrome, and has raised concerns that other species of abalone may also be in danger from contagious pathogens. Laboratory studies of the bacterium responsible for Withering Syndrome, Candidatus xenohaliotis californiensis, indicate that it is capable of infecting other species of abalone (Lafferty and Kuris 1993). Furthermore, the bacterium could be viable in the cooler waters found in Washington and British Columbia (Lafferty and Kuris 1993), especially with the potential for rising sea temperatures due to global warming. Nonetheless, it is important to note that to date there have been no recorded instances of Withering Syndrome in pinto abalone. Furthermore, Tegner (2000) implicated abalone culturing enterprises in the spread of pathogens in some cases. The potential for acting as a vector warrants attention in the event that pinto abalone transplantations are attempted in the core distribution.

There are currently a number of conservation actions underway on behalf of the pinto abalone. A summary of these initiatives is presented below, separated into initiatives underway in British Columbia, and those underway in the other regions of abalone distribution.

Conservation Action in British Columbia
The Committee on the Status of Endangered Wildlife in Canada (COSEWIC) assessed the pinto abalone as a “threatened” species in 1999. All such designations in Canada require the drafting of a National Recovery Strategy (NRS), followed by the creation of a National Recovery Action Plan (NRAP) (SARA 2002). The recovery strategy was completed in 2002 (Toole et al. 2002), and the latest draft of the action plan was released in August 2003 (NRAP 2003). The NRAP set forth a number of initiatives grouped under four main categories: a proactive protection plan, a communications campaign, proposed research, and a population-rebuilding plan. The actions are aimed at protecting the remaining wild stock of pinto abalone, increasing public support, augmenting the wild population, conducting research, and monitoring the status of the pinto population. Support for the initiatives comes from federal, provincial, private sector, and community partnerships.

The measures included under the proactive protection plan revolve around the challenge of curtailing illegal harvest; poaching represents one of the largest threats to the species. Efforts involved with increasing the enforcement of current laws include augmenting the number of fishery officers, adding a canine unit to improve detection of illegally harvested abalone at key locations such as ferries and airports, and developing methods for genetically sampling the commercially traded abalone (NRAP 2003). In addition, the NRAP calls for instituting a market analysis to determine the full extent of the illegal pinto abalone trade. Developing a “Coast Watch” program under the lead of First Nations and coastal communities is a further effort to improve monitoring efforts in more remote areas.

The communications campaign is aimed at increasing public awareness of the decline of the pinto abalone, and the ongoing efforts to engineer its recovery. The NRAP called for the creation of a dedicated abalone home page to act as a clearinghouse for news and knowledge and the production of an anti-poaching poster (both completed as of 2004). Materials and education kits are intended for use in school education sessions, while a whole media relations campaign is designed to support the Coast Watch initiatives, and provide positive feedback for the enhanced enforcement actions (NRAP 2003).

Research and population rebuilding efforts are closely related parts of the NRAP. The research portion involves feasibility studies aimed at determining the best methods for abalone rebuilding projects, the specifics of pinto abalone recruitment, the actual risks posed by disease as well as the best means of prevention and control, and many other aspects of the biology, physiology and ecology of the pinto abalone that remain unknown or uncertain (NRAP 2003). The population rebuilding efforts are directed at three fronts in British Columbia: the aggregation of reproductive-aged wild adult pinto abalone, the out-planting of hatchery-reared juvenile abalone, and the small scale enhancement of abalone habitat with the aim of improving survivability of juveniles. To date, aggregation experiments have been performed in several locations; however, the results of these studies have yet to be published. Two organizations, the Bamfield Huu-y-aht Community Abalone Project (BHCAP) and the Malcolm Island Shellfish Cooperative (MISC) have both begun rearing pinto abalone. The BHCAP performed Canada’s first out-planting in November of 2003, although to date, any results remain unpublished. MISC intended to perform out-plantings in November of 2003 as well, but the progress of the project remains unknown.

Monitoring projects are a vital component of any rebuilding effort. Along with continuing to survey the index sites in the Queen Charlotte Islands and the central coast of British Columbia, new baseline sites are proposed in regions across the provincial coastline to determine the effects any and all rebuilding efforts in the future.

Conservation Action in the other regions
In 1994, the Washington Department of Fish and Wildlife closed the pinto abalone fishery but did not initiate any conservation efforts. In 2004, the National Marine Fisheries Service listed the pinto abalone as a “Candidate Species” in the state of Washington for protection under the Endangered Species Act (NMFS 2004a). This designation, however, does not confer any procedural protections under the Endangered Species Act.

In California, after a series of closures of the various targeted abalone fisheries (of which pinto abalone did not play a significant role), fisheries managers enforced a moratorium on the taking, possessing and landing of all abalone species for commercial or recreational purposes south of San Francisco (CDFG 2003). The same bill, AB 663, mandated the creation of an Abalone Recovery Management Plan (ARMP). Pinto abalone are included in the ARMP only indirectly, as they are insufficient in numbers to support any form of targeted management or harvest (CDFG 2003). The recovery plan calls for a 7-year timeline starting in 2003 for implemented various activities and programs that focus on research, assessment and enforcement of regulations (CDFG 2003) that are similar in focus to those outlined in the British Columbia management and recovery plan.

Analysis of Current Conservation Efforts and Suggestions for New Efforts
Supplementation of abalone populations holds promise for accelerating the recovery of pinto abalone numbers. Reintroduction of hatchery-raised juveniles, however, has proved costly and ineffective in the past despite much effort and research (Davis et al. 1998, Tegner 2000). Additionally, there have been numerous examples of juvenile supplementation programs introducing pathogens into wild populations (reviewed in Tegner 2000). In consideration of these two issues, the current enthusiasm for hatchery-based supplementation in the British Columbian plan does not seem to be warranted. In contrast, experiments with transplantation of wild adult brood stock have had some success (Jamieson and Caddy 1986, Tegner 2000), and we recommend that resources be shifted towards this approach.

In the interests of providing sustainable incomes to the areas most affected by the decline of the pinto abalone, and in the interests of mitigating the impact of poaching upon remaining wild stocks, economic development alternatives should be sponsored in targeted regions. This activity should also be partnered with initiatives to promote community stewardship of remaining wild abalone as the distributed nature of the stock necessitates local support for any rebuilding projects. For this reason, “Coast Watch” and other initiatives that raise stakeholder awareness and participation are a step in the right direction.

Future Research
The collection of fisheries independent data for Alaska could provide a much clearer picture of the status of the pinto abalone. The creation of a number of index monitoring sites throughout the Alaskan range would provide a more realistic outlook of the abalone’s status than merely relying on the data available from British Columbia. Furthermore, index sites could provide information as to how the Alaskan abalone populations were coping with the stresses of sea otter expansion, and the overall recovery of the south central Alaskan coast after the crisis of the Exxon Valdez in 1990.

Further investigations of stock-recruitment relationships are needed to identify a healthy and viable population composition as well as a better understanding of the specific pinto abalone age-length relationship. Many of these research topics, including research into the genetics of the pinto abalone are called for in the various recovery and management plans (Toole et al. 2002, CDFG 2003, NRAP 2003). This information would be useful for scientists to estimate if a local cluster can sustain itself, and if not, to promote further action. This research would also aid fishery managers in setting reliable size quotas if the fishery re-opens. In addition, these studies could gather data about the ability of abalone to re-aggregate after exploitation.

Finally, the capability of Withering Syndrome to infect and spread in pinto abalone populations requires further investigation. Pinto abalone culturing and adult transplantation projects would be efficient vectors to spread the disease into wild populations; such was the case in black abalone populations (Petrovic et al. 2001).