Lithobates catesbeianus

License:

Rights Holder:

Distribution

Geographic Range

North American bullfrogs (Rana_catesbeiana) are only native to the Nearctic region. They are found from Nova Scotia to central Florida, from the East coast to Wisconsin, and across the Great Plains to the Rockies. The natural western limits of this species are now confused due to their introduction into places as far west as California and Mexico. It is known that bullfrogs were introduced to areas of California and Colorado in the early 1900's. The species has also been introduced (accidentally or on purpose) into southern Europe, South America, and Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced )

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Distribution and Habitat

R. catesbeiana is widely distributed in eastern North America, ranging from Nova Scotia to central Florida and west to eastern Wyoming, Colorado and New Mexico. It occurs throughout most of Texas and into northwestern Mexico. It has been widely introduced for a variety of purposes, and is now common in many parts of western North America and many other countries, including those in Europe, Asia and South America (e.g., see Lever 2003). Rana catesbeiana is strongly aquatic, and can be found primarily at the edges of lakes, marshes, or cypress bays (Conant and Collins 1975).

References:

Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Fa, J.E., Soy, J.P., Capote, R., MartÃnez, M., FernÃ¡ndez, I., Avila, A., RodrÃguez, D., RodrÃguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
Ficetola, G. F., CoÃ¯c, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
Hanselmann, R., RodrÃguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., RodrÃguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
Kaefer Ã.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
Laufer, G., Canavero, A., NÃºÃ±ez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
Mueses-Cisneros, J.J. and BallÃ©n, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de BogotÃ¡.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La âârana toroââ en la Selva AtlÃ¡ntica Interior Argentina: un nuevo problema de conservaciÃ³n.'' Cuadernos de HerpetologÃa, 20, 37-40.
Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''IntroducciÃ³n de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
SÃ¡nchez, D., ChacÃ³n-Ortiz, A., LeÃ³n, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.

Source:

License:

Rights Holder:

Range Description

This is a very wide-ranging species. Its native range is from Nova Scotia and New Brunswick, southern Quebec, Canada, south to eastern North America, except southern Florida, USA, then southward through Veracruz, Mexico. It is also found in Sinaloa, and probably other areas in Mexico, as well (these are not shown on the map). This species was introduced to Mexico at the beginning of last century. It was introduced to 'La Garita' in Costa Rica, but now appears to be extinct in this country (G. Chaves pers. comm.). It is also introduced in Cuba, Puerto Rico (introduced 1935), Hawaii (introduced mid- to late 1800s, now on all main islands), Isla de la Juventud, Hispaniola (only confirmed in northern and eastern Dominican Republic, not in Haiti) and Jamaica. Its range is increasing in some areas. It is introduced to South America. In Venezuela, there is an expanding population near La Azulita, in Mérida state, at the Andean versants facing Lake Maracaibo basin. In Colombia it is known from the Middle Magdalena Valley, north to the lowlands on the Caribbean coast. It has also been found in Bogotá, although it is not known whether it has established a population there. In Peru it has become established around Iquitos in central Loreto Department in the Amazon Basin, and also around Lima on the Pacific coast. There are also a number of populations established in Ecuador and Brazil. It has been introduced in Rincón de Pando, Canelones, Uruguay, and in Misiones, Argentina. In Europe, where it is introduced, the largest population occurs within the Po River Valley (Italy) where formal introductions continued at least until 1937. Other populations have been reported from Belgium (recorded from several sites in Wallonia and at least one population is known in Flanders), the Netherlands, central and southwestern France, Germany (in the vicinity of Bonn and also in Baden-Wuttemburg), Greece (Crete), Spain (Gran Canaria in the Canary Islands [only a few individuals observed and not mapped here], Villasbuenas de Gata in Cacerés [not recently observed and not mapped here] and Sierra de Collserola, Cataluña Province [only a few individuals observed and not mapped here]) and the United Kingdom (possibly now eradicated). It has possibly been introduced to Switzerland, although this requires further confirmation. In Asia, where it is also introduced, it is found in several localities in the Philippines, Malaysia, Indonesia, Thailand [not mapped here] and Singapore [not mapped here]. It has been introduced to mainland China and Taiwan, Province of China, for raising in farms for human consumption. Feral populations have become established in Taiwan, Province of China, Kunming in Yunnan province, Sichuan, Xinjiang and possibly other places in China as a result of escape or deliberate release. Individuals have been found in the wild in Hong Kong probably from releases of market animals. However, there is no evidence to suggest that this species is now established in Hong Kong. It is found widely from southern Hokkaido to Ishigakijima in Japan.

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Geographic Range

North American bullfrogs (Lithobates catesbeianus) are only native to the Nearctic region. They are found from Nova Scotia to central Florida, from the East coast to Wisconsin, and across the Great Plains to the Rockies. The natural western limits of this species are now confused due to their introduction into places as far west as California and Mexico. It is known that bullfrogs were introduced to areas of California and Colorado in the early 1900's. The species has also been introduced (accidentally or on purpose) into southern Europe, South America, and Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced )

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The native range extends from Nova Scotia, New Brunswick, and southern Quebec, Canada, west to the Great Lakes region, and south through most of the central and eastern United States and south into northeastern Mexico. The western limits of the native range are ambiguous due to widespread introductions in western North America. The species also has been introduced and is established in the Greater Antilles, Hawaii, and many other locations worldwide.

Source:

License:

Rights Holder:

NatureServe

occurs (regularly, as a native taxon) in multiple nations

Source:

License:

Rights Holder:

NatureServe

Morphology

Physical Description

Bullfrogs are the largest real frog found in North America, weighing up to 0.5 kg and measuring 460 mm in length. Their average length is 100-175 mm. Their color varies from brownish to shades of green, often with spots or blotches of a darker color around their backs. Their back feet are fully webbed. The sex of an adult bullfrog can be found out easily by examining the size of the tympanum (the external ear of the frog) relative to size of the eye. The tympanum is a round circle located on the side of the head near the eye, and in males it is much larger than the eye. In females the tympanum is as large or smaller than the eye. Also, during the breeding season the throat of the male bullfrog is yellow, and the female's is white.

Range mass: 0.5 (high) kg.

Range length: 460 (high) mm.

Average length: 100-175 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Physical Description

North American bullfrogs are the largest true frog found in North America, weighing up to 0.5 kg and 203 mm in length. Typical length ranges from 90 to 152 mm. Color varies from brownish to shades of green, often with spots or blotches of a darker color about the back. The hind feet are fully webbed. The sex of an adult bullfrog can be easily determined by examining the size of the tympanum (the external ear of the frog) relative to that of the eye. The tympanum is a round circle located on the side of the head near the eye, and in males it is much larger than the eye. In females the tympanum is as large or smaller than the eye. Also, during the breeding season the throat of the male bullfrog is yellow, whereas the female's is white.

Range mass: 0.5 (high) kg.

Range length: 460 (high) mm.

Average length: 100-175 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Average basal metabolic rate: 0.0134 W.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Size

Length: 20 cm

Source:

License:

Rights Holder:

NatureServe

Habitat

North American bullfrogs need to live in water and are therefore usually found near some source of water, like a lake, pond, river, or bog. Warm, calm, shallow waters are their favorite places. Bullfrogs are becoming much more common in areas that have been changed by humans. Increased water temperatures and increased amounts of water plants, which are common signs of lakes that have been polluted by humans, favor bullfrogs by providing good habitats for growth, reproduction, and escape from predators.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Habitat and Ecology

This species inhabits ponds, swamps, lakes, reservoirs, marshes, brackish ponds (in Hawaii), stream margins and irrigation ditches. It is sometimes found in temporary waters hundreds of metres from permanent water. It winters at the bottom of pools. It may disperse from water in wet weather. Eggs and larvae develop in permanent slow or non-flowing bodies of water.

Systems

Terrestrial
Freshwater

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Habitat

North American bullfrogs must live in water and are therefore usually found near some source of water, such as a lake, pond, river, or bog. Warm, still, shallow waters are preferred. Bullfrogs are becoming increasingly common in areas that have been modified by humans. Increased water temperatures and increased aquatic vegetation, which are common factors of lakes polluted by humans, favor bullfrogs by providing suitable habitats for growth, reproduction, and escape from predators.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Comments: American bullfrogs inhabit ponds, swamps, lakes, reservoirs, marshes, brackish ponds (e.g., Hawaii), stream margins, and irrigation ditches, especially sites with abundant floating, emergent, or submerged vegetation. They may disperse from water in wet weather and sometimes are found in temporary waters hundreds of meters from permanent water. Bullfrogs sometimes make seasonal migrations to and from ephemeral bodies of water, or between adjacent permanent aquatic habitats. Individuals often remain in one pond or in a cluster of adjacent ponds throughout a season but may move up to a mile or more from one year to the next. Breeding sites are primarily permanent slow- or nonflowing bodies of water.

Source:

License:

Rights Holder:

NatureServe

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May make seasonal migrations to and from ephemeral bodies of water, or between adjacent permanent aquatic habitats. Usually remains in one pond or in a cluster of adjacent ponds throughout season but may move up to a mile or more from one year to the next. In Missouri, Willis et al. (1956) found that R. catesbeiana made interpond movements of 0.16-2.8 km.

Source:

License:

Rights Holder:

NatureServe

Trophic Strategy

Food Habits

Bullfrogs are predators. They usually eat serpentes, Annelida, insecta, crustacea, anura, tadpoles, and aquatic eggs of actinopterygii, frogs, insects, or caudata. They are cannibalistic and will not hesitate to eat their own kind. There have also been a few cases reported of bullfrogs eating chiroptera. Bullfrog tadpoles mostly graze on aquatic plants.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: algae

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Food Habits

Bullfrogs are predators. They usually eat snakes, worms, insects, crustaceans, frogs, tadpoles, and aquatic eggs of fish, frogs, insects, or salamanders. They are cannibalistic and will not hesitate to eat their own kind. There have also been a few cases reported of bullfrogs eating bats. Bullfrog tadpoles mostly graze on aquatic plants.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: algae

Primary Diet: carnivore (Eats terrestrial vertebrates); herbivore (Algivore)

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Comments: Metamorphosed frogs eat any animal that can be captured and swallowed, including all kinds of vertebrates and invertebrates. Larvae eat suspended matter, organic debris, algae, plant tissue, and small aquatic invertebrates.

Source:

License:

Rights Holder:

NatureServe

Associations

Predation

Humans hunt bullfrogs for frog legs, but they have a limited hunting season in most states. Bullfrogs are also eaten by a wide variety of other animals, depending on the region. These include ardeidae, such as Ardea herodias and Ardea alba, testudines, Nerodia, procyon lotor, and Ceryle alcyon. Most fish are averse to eating bullfrog tadpoles because of their undesirable taste.

Known Predators:

great blue herons (Ardea_herodias)
great egrets (Ardea_alba)
belted kingfishers (Ceryle_alcyon)
turtles (Testudines)
water snakes (Nerodia)
raccoons (Procyon_lotor)

Source:

License:

BioImages - the Virtual Fieldguide (UK)

Rights Holder:

The Regents of the University of Michigan and its licensors

Associations

In Great Britain and/or Ireland:
Fungus / infection vector
Batrachochytrium dendrobatidis is spread by Rana catesbeiana

Source:

License:

Rights Holder:

BioImages

Predation

Humans hunt bullfrogs for frog legs, but they have a limited hunting season in most states. Bullfrogs are also eaten by a wide variety of other animals, depending on the region. These include herons, such as great blue herons and great egrets, turtles, water snakes, raccoons, and belted kingfishers. Most fish are averse to eating bullfrog tadpoles because of their undesirable taste.

Known Predators:

great blue herons (Ardea herodias)
great egrets (Ardea alba)
belted kingfishers (Megaceryle alcyon)
turtles (Testudines)
water snakes (Nerodia)
raccoons (Procyon lotor)

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Known prey organisms

Rana catesbeiana preys on:
Chelydra serpentina
Diadophis punctatus
Anas fulvigula
Bombycilla cedrorum
Parascalops breweri

This list may not be complete but is based on published studies.

References:

Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org

Source:

SPIRE

License:

Rights Holder:

SPIRE project

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout most of the range.

Source:

License:

Rights Holder:

NatureServe

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but clearly exceeds 1,000,000 individuals.

Source:

License:

Rights Holder:

NatureServe

General Ecology

Introduced bullfrogs apparently have detrimental effects on populations of native ranid frogs.

Bullfrog larvae generally are not palatable to fish predators but are sensitive to invertebrate predators (e.g., see Smith et al. 1999).

Bullfrogs in hand may go limp, then suddenly "revive" and leap away. Sometimes they produce a loud open-mouthed call lasting up to several seconds.

Source:

License:

Rights Holder:

NatureServe

Behavior

Communication and Perception

The call of a male bullfrog has a low frequency and can be heard for over one kilometer. The sound is often described as a low rumbling "jug-o-rum". Bullfrogs also have a good sense of vision and sense vibrations. See a video of a bullfrog calling here: http://www.midwestfrogs.com/.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Communication and Perception

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Cyclicity

Comments: Bullfrogs are easily observed in daytime or (with a light) at night; movements and breeding activity during summer occur mostly at dusk and at night, though calling commonly occurs in daytime as well. Bullfrogs are relatively inactive during cold winter months, where they situate themselves at the bottom of pools or under various sorts of cover in or near water.

Source:

License:

Rights Holder:

NatureServe

Life Cycle

Development

About four days after fertilization, spotted tadpoles emerge from the floating egg mass. The tadpoles have gills and a tail, which eventually disappears as the tadpole transforms into a froglet. Tadpole development is quite slow; it may take between one to three years to begin transformation from the tadpole stage into the adult stage. Adults reach sexual maturity after an additional two years.

Development - Life Cycle: metamorphosis

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Development

Development - Life Cycle: metamorphosis

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Life Expectancy

Lifespan/Longevity

The average bullfrog lives seven to nine years in the wild. The record lifespan of an animal in captivity is 16 years.

Range lifespan
Status: captivity: 16 (high) years.

Typical lifespan
Status: wild: 7 to 9 years.

Average lifespan
Status: wild: 7-9 years.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Lifespan/Longevity

The average bullfrog lives seven to nine years in the wild. The record lifespan of an animal in captivity is 16 years.

Range lifespan
Status: captivity: 16 (high) years.

Typical lifespan
Status: wild: 7 to 9 years.

Average lifespan
Status: wild: 7-9 years.

Average lifespan
Sex: male
Status: captivity: 6.6 years.

Average lifespan
Status: captivity: 8.0 years.

Average lifespan
Status: captivity: 16.0 years.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity) Observations: Increased reproductive output with age has been documented in these animals (Caleb Finch 1990). Record longevity may be underestimated. In the wild, mortality rates appear to rise at later ages. Growth rates also appear to decline (Kara 1994).

Source:

AnAge

License:

Rights Holder:

Joao Pedro de Magalhaes

Reproduction

Mating System: polygynous

Breeding takes place in May to July in the north, and from February to October in the south. Fertilization is external, with the females depositing as many as 20,000 eggs in a foamy film in quiet, protected waters. Fertilization is usually, but not always, by one male. Tadpoles emerge about four days after fertilization. These tadpoles may remain in the tadpole stage for almost 3 years before transforming into frogs. Adults reach sexual maturity after 3 to 5 years.

Breeding interval: Bullfrogs breed once each year.

Breeding season: May to July in the north and February to October in the south

Range number of offspring: 20000 (high) .

Average time to hatching: 4 days.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Females provide the eggs with yolk before they are laid. There is no parental involvement in offspring after the eggs are laid. Newly hatched tadpoles can take care of themselves right away.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Reproduction

Mating System: polygynous

Breeding interval: Bullfrogs breed once each year.

Breeding season: May to July in the north and February to October in the south

Range number of offspring: 20000 (high) .

Average time to hatching: 4 days.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Females provide the eggs with yolk before they are laid. There is no parental involvement in offspring after the eggs are laid. Newly hatched tadpoles can take care of themselves right away.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Breeding occurs when water temperatures are relatively warm, mainly in May-July in the northern part of the range, primarily late spring to late summer in Georgia, and mainly March through summer in Louisiana. Individual females produce 1-2 clutches/year. Larvae hatch in 4-20 days. In most areas, larvae overwinter at least once before metamorphosing, but larvae metamorphose in less than a year in warm climates (e.g., 5-6 months in Louisiana; less than 6 months in Hawaii, Tinker 1941). Individuals become sexually mature an average of 1-5 years after metamorphosis, with the oldest ages of maturity occurring in environments with the shortest growing seasons (e.g., average of 5 years after metamorphosis in central Ontario females); in a particular location, males tend to mature a year or so earlier than do females (Shirose et al. 1993).

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

NatureServe

Molecular Biology

Statistics of barcoding coverage: Lithobates catesbeianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

Barcode of Life Data Systems

Barcode data: Rana catesbeiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 14 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTACTTAGTCTTCGGTGCNTGAGCCGGGATAGTCGGAACAGCCCTAAGTCTGCTGATTCGCGCAGAACTAAGCCAGCCAGGAACCCTCCTTGGCGACGATCAAATCTACAATGTTATCGTTACTGCTCACGCATTTGTTATAATTTTCTTCATAGTTATGCCTATCCTAATTGGAGGCTTTGGAAACTGACTAGTCCCCTTAATGATTGGGGCCCCTGATATAGCCTTCCCCCGAATAAATAACATGAGCTTTTGACTTCTCCCTCCATCCTTCTTTCTTCTACTAGCTTCTTCCACAGTTGAAGCCGGGGCTGGCACAGGCTGAACAGTCTACCCCCCTCTAGCTGGGAACCTAGCCCACGCAGGCCCATCTGTAGATCTAGCTATTTTCTCGCTACATTTAGCTGGGGTATCCTCTATTCTAGGGGCTATTAATTTTATTACTACAATTATTAATATGAAGCCATCCTCAACTACACAATACCAAACACCTTTATTCGTCTGATCAGTTTTAATTACCGCAGTTCTACTACTTTTATCCCTTCCAGTATTAGCTGCCGGAATTACTATACTCCTCACAGATCGAAACCTAAACACCACATTTTTCGACCCGGCAGGAGGCGGAGATCCTGTTCTTTATCAACATTTATTC
-- end --

Download FASTA File

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

Barcode of Life Data Systems

Statistics of barcoding coverage: Rana catesbeiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1

Source:

License:

Rights Holder:

Barcode of Life Data Systems

Conservation Status

Bullfrogs are dealing fairly well with the changes in the environment that have occurred due to human influences, and they are becoming increasingly common in areas that have been modified by humans. Bullfrogs have a much higher critical thermal maximum than most other frogs, meaning that they are able to thrive in higher water temperatures. Bullfrogs have a longer breeding season and a high rate of surviving through the tadpole stage, which allows them to be more successful than other frogs. In many areas, such as California and Colorado, bullfrogs are driving other frog populations to extinction. An interesting reason to explain why bullfrogs in California might have an advantage over other species that are native to that state is that bullfrogs evolved with many different kinds of fish in eastern North America. For many years in California people have been introducing new fish species that are predators of frogs. Bullfrogs have evolved ways to avoid being eaten by fish, such as tadpoles that are not active much of the time which reduces their exposure to predators. Native frog species of California are also suffering a decline because bullfrogs are intense predators on frog populations.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

IUCN Red List Assessment

Red List Category

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2009

Assessor/s

Santos-Barrera, G., Hammerson, G., Hedges, B., Joglar, R., Inchaustegui, S., Lue Kuangyang, Chou Wenhao, Gu Huiqing, Shi Haitao, Diesmos, A., Iskandar, D., van Dijk, P.P., Masafumi Matsui, Schmidt, B., Miaud, C. & Martínez-Solano, I.

Reviewer/s

Cox, N. & Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History

2004

Least Concern

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Conservation Status

Bullfrogs do well with changes in the environment that have occured due to human modification, and are becoming increasingly common in areas modified by humans. Bullfrogs have a much higher critical thermal maximum than most other frogs, meaning that they are able to thrive in higher water temperatures. Bullfrogs have a longer breeding season and a higher rate of pre-metamorphic survivorship, which also allows them to be more successful than other frogs. In some areas, such as California, bullfrogs are driving other frog populations to extinction. One possible reason to explain why bullfrogs in California might have an advantage over other species native to that state is that bullfrogs evolved with a diverse predatory fish fauna in eastern North America. In California there have been attempts to control bullfrog populations by introducing new fish species that are their predators. Bullfrogs have evolved mechanisms to avoid predation by fish, such as less palatable eggs and tadpoles, and tadpoles that are not active much of the time, which reduces their exposure to predators. Native frog species of California are also suffering a decline because bullfrogs are efficient predators of frogs and tadpoles.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Source:

License:

Rights Holder:

NatureServe

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Source:

License:

Rights Holder:

NatureServe

Trends

Life History, Abundance, Activity, and Special Behaviors

The breeding season begins in spring and lasts throughout early summer, but can vary according to latitude. Bullfrogs breed on the surface of shallow, permanent water covered with vegetation. Males make distinctive resonant low-pitched calls with a single note that lasts 0.8 seconds at a frequency of 1.0 kHz. Males also display aggressive territorial behavior in defending good oviposition sites. One clutch consists of up to 20,000 eggs and one quarter of the female's body weight. Duration of the larval stage varies greatly depending on the temperature. Metamorphosis is not synchronized.Bullfrogs are often the predominant species in interspecific relationships, contributing to the decline of other amphibians and excluding them from the habitat. Bullfrog juveniles are adept at colonizing new ponds, and they are believed to disperse throughout an environment this way. Bullfrogs are opportunistic predators, and prey on any animal smaller than themselves. While smaller bullfrogs eat mostly insects, larger bullfrogs consume aquatic species such as fish and crayfish, mice, and other frogs (for a video, see the account on Bufo californicus). Cannibalism is prevalent in a bullfrog's diet, sometimes comprising up to 80% of its food.

For additional details on Life History, please refer to the Lannoo account (click on yellow tab above).

References:

Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Fa, J.E., Soy, J.P., Capote, R., MartÃnez, M., FernÃ¡ndez, I., Avila, A., RodrÃguez, D., RodrÃguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
Ficetola, G. F., CoÃ¯c, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
Hanselmann, R., RodrÃguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., RodrÃguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
Kaefer Ã.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
Laufer, G., Canavero, A., NÃºÃ±ez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
Mueses-Cisneros, J.J. and BallÃ©n, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de BogotÃ¡.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La âârana toroââ en la Selva AtlÃ¡ntica Interior Argentina: un nuevo problema de conservaciÃ³n.'' Cuadernos de HerpetologÃa, 20, 37-40.
Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''IntroducciÃ³n de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
SÃ¡nchez, D., ChacÃ³n-Ortiz, A., LeÃ³n, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.

Source:

License:

Rights Holder:

Population

There are thousands of occurrences of this species. It is highly abundant and its global population is increasing. Although some of the populations in Europe of this species are increasing, other introductions not have become fully established. In Asia, it is only present in isolated pockets. Animals have been deliberately introduced to northern Thailand in the hope of augmenting native frog production. Farmed animals are exported alive to East Asia (Pariyanonth and Daorerk 1995, Lim and Lim 1992) and can escape or be released to become established. A growing population is now established in the Venezuelan Andes (C. Gottberg and A. Diaz pers. comm.), near the town of Jají, in Mérida State.

Population Trend

Increasing

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Global Short Term Trend: Increase of 10 to >25%

Comments: Likely increasing.

Global Long Term Trend: Increase of >25%

Comments: Has increased in all aspects through introductions and subsequent unaided spread.

Source:

License:

Rights Holder:

NatureServe

Threats

Degree of Threat: Low

Comments: There are no threats to this species. Outside of the United States this species is considered a pest.

Source:

License:

Rights Holder:

NatureServe

Life History, Abundance, Activity, and Special Behaviors

Introduced populations present great threats to native frogs, due to the bullfrog's voracious feeding habits and the size and competitive ability of the larvae. Although aquatic species and frogs constitute a major portion of its diet, other native species are also likely affected because bullfrogs have been reported to eat snake, birds, and small mammals as well. Furthermore, as bullfrogs are being introduced worldwide, they serve as carriers of the pathogenic fungus Batrachochytrium dendrobatidis (chytrid), which causes the lethal disease chytridiomycosis, believed to be a major factor in recent global amphibian declines (e.g., Garner et al. 2006 found that bullfrogs were consistently chytrid-infected in multiple countries). Infected bullfrogs appear to be rather resistant to chytridiomycosis, whereas the disease is lethal to many other amphibians, making the bullfrog an efficient carrier of the chytrid fungus (Daszak et al. 2004).Argentina: Introduced populations of R. catesbeiana have been recently reported in San Juan (Sanabria et al. 2005), Misiones (Pereyra et al. 2006), Buenos Aires (Barrasso et al. 2009), and Córdoba and Salta provinces (Akmentins and Cardozo 2009). Most introductions come from intentional or incidental releases from breeding facilities, except for Misiones where the bullfrogs there are believed to be the result of the range expansion of a Brazilian population (Pereyra et al. 2006). The bullfrog's adaptive ability has allowed it to invade a diversity of environments and disperse throughout Argentina. It has been observed to prey on native vertebrates. Although it has not yet been identified as a chytrid carrier in Argentina, its negative influence as a potential disease carrier remains to be further examined. One Argentinian species greatly affected by the presence of R. catesbeiana is Leptodactylus ocellatus, a generalist predator who shares a similar diet with R. catesbeiana and whose larvae are being preyed on by bullfrogs (Barrasso et al. 2009). The increase in number of captive-breeding facilities due to a large demand for human consumption and the lack of effective governmental control thereof are serious concerns in Argentina (Akmentins and Cardozo 2009).Belgium: Bullfrog larvae have been imported on a large scale for trade in pet shops. Many specimens were released into the wild and were able to survive to reach adulthood (Stumpel 1992). Free-ranging populations of R. catesbeiana have been observed in Belgium (Ficetola et al. 2006). Conservationists are concerned about the potential threat of R. catesbeiana to indigenous species, in particular Rana esculenta, which occupies the same niche (Stumpel 1992).Brazil: Introductions date as early as the 1930's in association with aquaculture. Except for the coldest months of the year, R. catesbeiana reproduces continuously during warm weather such as that of Brazil (Kaefer et al. 2007). This characteristic is shared with the cane toad (Bufo marinus, another invasive species in Brazil. The degree of native population loss brought on by the introduction of bullfrogs is still being speculated, but the reproductive ability of R. catesbeiana is worrisome. Giovanelli et al. (2008) propose that the Brazilian Atlantic Forest biodiversity hotspot in southern and southeastern Brazil may be the most susceptible to invasion, based on ecological niche modeling. Furthermore, a chytridiomycosis outbreak in an Uruguayan farm with stock that originated from Brazil suggests that Brazilian rearing facilities may contain specimens that are infected by B. dendrobatidis, and could thus be harmful to native anuran species if allowed to escape (Mazzoni et al. 2003). These authors urge the Brazilian government to regulate human introductions of R. catesbeiana more strictly.China: R. catesbeiana was first introduced to China in 1959. Since then, breeding populations have been established in most provinces of mainland China including Yunnan, Sichuan, Shanxi, and Zhejian Provinces (Wang et al. 2007). The bullfrog has been widely bred for both local consumption and for export since the 1980s (Wu et al. 2005). Escapes occur from rearing pens or in the process of transportation or trade (Wu et al. 2005; Li et al. 2006; Liu and Li 2009). R. catesbeiana poses a great threat to native anuran species due to its voracious feeding habits. Its body size is also much larger than any other native species, and it is known to consume at least 4 of the 10 native species in the Zhoushan archipelago of Zhejian Province. Wang et al. (2007) quantified the predatory impacts of R. catesbeiana and found that body size plays an important role in predator-prey interactions with native anurans of China. It has been suggested that the primary threat posed by juvenile bullfrogs is food competition, whereas the primary threat posed by adult bullfrogs is predation (Wu et al. 2005). Chytridiomycosis has also been reported from introduced bullfrogs (wild, farmed, and market-sold) in Yunnan province, as well as in native amphibians, suggesting that farmed and escaped bullfrogs may present a major threat to native species by carrying disease as well (Bai et al. 2010).Colombia: R. catesbeiana was introduced into Colombia in the 1990s and inhabits the inter-Andean valleys (Lynch 2006a). The bullfrog was originally introduced in hopes of exploiting it for food consumption, but it is now a biological plague in the valley of the Río Cauca and in certain localities on the western slopes of the Cordillera Oriental in Cundinamarca, as well as the lowlands of the Caribbean Region (Lynch 2006b). Its diet in Colombia has been reported to consist mostly of insects (56%), whereas vertebrates constitute only 2% of the diet (Daza and Castro 1999). Many endogenous Colombian frog species have been impacted by the lethal fungal disease chytridiomycosis; R. catesbeiana is a potential vector in Colombia of the fungal pathogen Batrachochytrium dendrobatidis (Ruiz and Rueda-Almonacid 2008).Cuba: In the 1920s, both adult and larval bullfrogs were observed in two small ponds near Rincon, a small village approximately 50 kilometers from Havana. It was not deemed a threat to the ecological system in Cuba at that time because it was thought that the bullfrog, which had a larval period of more than one year, would not be able to breed in the many temporary pools in Cuba (Hoffman and Nobel 1927). Now, bullfrogs are present throughout Cuba except the Sierra del Cristal National Park (Fa et al. 2002).France: Acclimatized R. catesbeiana populations have been recorded in France beginning in the 1960s (Ficetola et al. 2006). It was observed to be occurring near Bordeaux in 1997, in a limited area of gravel pits (Neveu et al. 1997). Currently, southwest France is the European area where the strongest expansion of R. catesbeiana is taking place; it also represents the second largest area in Europe where R. catesbeiana is present, constituting about 2,000 square km. Only three breeding populations have been reported, but observations of isolated individuals suggest that translocations are frequent. These secondary translocations facilitated by humans can substantially increase the rate of population expansion, which may further enhance capture and translocation. A large-scale eradication plan is being carried out in southwest France, including trapping of both adults and tadpoles, and education of local people (Ficetola et al. 2006). Unfortunately, samples of introduced populations of bullfrogs in Loir et Cher are found to be infected with B. dendrobatidis (Garner et al. 2006).Italy: R. catesbeiana was introduced to Italy in the 1930s, making it the first European country where this species was successfully introduced (Ficetola 2006). It is well established in northern Italy and breeds abundantly. Provinces affected at least since 1960 include Mantova, Pavia, and Verona (Lanza 1962). In northern Italy, the R. catesbeiana population does not appear to have expanded since the 1980's. Some populations are known to be infected by B. dendrobatidis (Ficetola 2006).Jamaica: Twenty-two R. catesbeiana specimens were first introduced to the Great Morass of the Black River of Jamaica in 1967 for commercial purposes. During the next 4 years it has spread in all directions from the point of introduction and eventually established themselves in the Upper Morass. Although no quantitative population estimates have been conducted, R. catesbeiana appears to have established extensive populations at suitable habitat areas of the island. Its expansion in Jamaica is further facilitated by temperature and lack of competition; the frogs breed continually throughout the year and displace local anurans such as Bufo marinus through habitat competition (Mahon and Aiken 1977).Japan: R. catesbeiana was first introduced to Japan by a professor at the Imperial University of Tokyo (now Tokyo University) around 1918 (Okada 1927). The frog was already well integrated into the Japanese herpetofauna by 1958-1959, approximately 40 years after its introduction (Telford 1960). R. catesbeiana is firmly established in at least the Kanto and Kansai Plains, the two largest lowland regions of Japan, and many local people recognize it as the "food frog" (Telford 1960). R. catesbeiana resides in freshwater habitats such as rice fields, ponds, and rivers. Studies reveal that it may negatively affect native anuran species such as the endangered Rana porosa brevipoda through predation and food competition. The removal of bullfrogs, along with other invasive exotic species, is highly recommended for conservation of local vertebrates (Hirai 2004). Studies reveal R. catesbeiana populations expanding in paddy fields prefer microhabitat with deep water; managing habitats to reduce immigration of bullfrogs may help prevent the spread of this invasive species (Minowa et al. 2008). A recent die-off of R. catesbeiana from ranavirus lasted from September through October 2008 in a 1000-m² pond in western Japan. Infected feral populations of R. catesbeiana presents a serious threat to Japanese amphibians (Une et al. 2009). Fortunately, B. dendrobatidis does not seem to have infected introduced populations of R. catesbeiana, and no die-off from chytridiomycosis has been reported (Garner et al. 2006).Netherlands: bullfrogs were imported for trade in pet shops in the 1980s. Many specimens are released into the wild as larvae or freshly metamorphosed juveniles. In 1991, a reproducing population since 1989 was recorded in a garden pond in the city of Breda (Stumpel 1992). Eradication programs have been carried out in the Netherlands (Scalera 2007).Puerto Rico: in 1935, the Insular Department of Agriculture and Commerce of Puerto Rico introduced a total of 40 R. catesbeiana specimens from Florida to a specially constructed pond at Rio Piedras. The population expanded successfully, and by 1951 had invaded the neighboring towns of Mayaguez and Humacao. It did not appear to prey on other amphibians, but did consume a diversity of local insects (Perez 1951).Taiwan: the species was introduced into Taiwan from the United States via Japan in 1924 and 1951 (Hsu et al. 1970). The country actively participates in the production of bullfrog meat, and in fact is the world's top exporter of ranids. However, its native amphibians are at risk of infection by B. dendrobatidis. Taiwan's subtropical climate also creates a suitable environment for the growth of this pathogen (Schloegel et al. 2009).Uruguay: R. catesbeiana was first introduced in 1987 for farming purposes, but at present most of the farms have closed down. A feral population was reported in 2008 at one of the closed farms at Rincón de Pando. Establishment of the population appears to be at an early stage but is potentially dangerous, as the invaded pond exhibits significant differences from non-invaded ones. For example, R. catesbeiana seems to have some type of positive interaction with fish, because the body size of common fish species are higher in the invaded pond where aquatic vertebrate richness is also highest. Furthermore, R. catesbeiana is the highest fraction of vertebrate biomass, displacing native amphibian species such as Hypsiboas pulchellus. Other negative effects on local amphibian fitness include reducing the premetamorphic period due to competition and predation pressures. The high level of anthropogenic disturbance and large amount of suitable habitat in Uruguay may facilitate R. catesbeiana expansion (Laufer et al. 2008). Recent mass deaths occurred at a large farming facility for bullfrogs 46 km from Montevideo, Uruguay, and the cause is suspected to be chytridiomycosis (Mazzoni et al. 2003). This is potentially dangerous to native anurans if R. catesbeiana were to serve as a carrier of B. dendrobatidis. However, no control program was implemented for these closed farms. Laufer et al. (2008) recommend taking measures against the population expansion as well as searching for new invasion points.Venezuela: the bullfrog was introduced as a food source around the 1990s, and has established dense populations in 14 natural and artificial ponds as far as 4.3 km away from the point of introduction. Examination of R. catesbeiana specimens in the Venezuelan Andes suggests that the bullfrog acts as a pathogen carrier that causes amphibian population declines in Venezuela (Hanselmann et al. 2004). 79.9% of the bullfrogs surveyed are infected with B. dendrobatidis and carrying an average of 2299 zoospores (Sánchez et al. 2008). Of the infected frogs, 96% appear otherwise healthy, making R. catesbeiana an efficient reservoir host. It is likely that year-round bullfrog breeding will heighten the impact of chytridiomycosis (Hanselmann et al. 2004). Chytridiomycosis is detected in native species occuring in pond, stream and terrestrial habitats from 80-2600 m. Dendropsophus meridensis, an endangered native species sympatric with R. catesbeiana, shows the highest infection prevalence and mean zoospore load (26.7% and 2749 zoospores). Although no clinical signs of disease were detected, environmental stress could potentially increase its vulnerability to the pathogen (Sánchez et al. 2008). B. dendrobatidis is also known to migrate through autoclaved late water to reach distant amphibian populations outside the range of R. catesbeiana dispersal (Hanselmann et al. 2004).R. catesbeiana has been introduced worldwide, and AmphibiaWeb is in the process of editing the Trends and Threats section of this page for each country.

References:

Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Fa, J.E., Soy, J.P., Capote, R., MartÃnez, M., FernÃ¡ndez, I., Avila, A., RodrÃguez, D., RodrÃguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
Ficetola, G. F., CoÃ¯c, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
Hanselmann, R., RodrÃguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., RodrÃguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
Kaefer Ã.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
Laufer, G., Canavero, A., NÃºÃ±ez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
Mueses-Cisneros, J.J. and BallÃ©n, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de BogotÃ¡.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La âârana toroââ en la Selva AtlÃ¡ntica Interior Argentina: un nuevo problema de conservaciÃ³n.'' Cuadernos de HerpetologÃa, 20, 37-40.
Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''IntroducciÃ³n de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
SÃ¡nchez, D., ChacÃ³n-Ortiz, A., LeÃ³n, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.

Source:

License:

Rights Holder:

Threats

Major Threats

There are no threats to this species. Outside its native range, this species is considered a pest. It has been observed predating on native species in Puerto Rico, including on Leptodactylus albilabris, and is a potential predator of other native species throughout its introduced range. It is a possible vector of pathogens.

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Management

Conservation Actions

There are no measures required to conserve this species. Instead, eradication of this species from its introduced range is a conservation priority. In Asia, this species is believed to have a negative impact on the native amphibian fauna. It should be monitored and controlled. Farming activities should concentrate on native Hoplobatrachus rugulosus. Farming of Lithobates catesbeianus should at least be strictly contained, including water discharges from farms that should be carefully controlled or prevented. Ideally, the farming of the species outside its range should be prohibited. Studies of actual and potential ecological impacts should be conducted, perhaps leading to an elimination programme. Awareness of the potential threat posed by this species to native biodiversity must be raised. The Venezuelan government has taken actions to avoid the spread of this species. There has been an eradication program, with participants from the University of Los Andes at Mérida, the Venezuelan Institute of Scientific Research (IVIC) and the Ministry of Environment, instated at the beginning of 2002.

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Management Requirements: See Bury and Whelan (1984) for management information.

Source:

License:

Rights Holder:

NatureServe

Benefits

Economic Importance for Humans: Negative

Introduced bullfrogs may be driving native frogs to extinction in some areas. Colorado, among many other places, is experiencing problems due to the introduced bullfrog population. Bullfrogs may have been introduced accidentally to trout streams and lakes during the Colorado Divisions of Wildlife fish stocking operations. Bullfrogs occasionally invade fish hatchery ponds and their larvae are caught along with the fishes that are routinely stocked in ponds.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Economic Importance for Humans: Positive

North American bullfrogs help to control insect pests. They are important for medical research because their skeletal, muscle, digestive, and nervous systems are similar to those of other animals. They are often hunted for meat (frog legs).

Positive Impacts: food ; research and education; controls pest population

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Economic Importance for Humans: Negative

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Economic Importance for Humans: Positive

Positive Impacts: food ; research and education; controls pest population

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Economic Uses

Comments: Harvested for meat in many areas.

Source:

License:

Rights Holder:

NatureServe

Risks

Relation to Humans

This large frog is widely farmed for human consumption as a source of meat, as well as for entertainment or as an agent to control pest population (Lever 2003).

References:

Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Fa, J.E., Soy, J.P., Capote, R., MartÃnez, M., FernÃ¡ndez, I., Avila, A., RodrÃguez, D., RodrÃguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
Ficetola, G. F., CoÃ¯c, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
Hanselmann, R., RodrÃguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., RodrÃguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
Kaefer Ã.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
Laufer, G., Canavero, A., NÃºÃ±ez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
Mueses-Cisneros, J.J. and BallÃ©n, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de BogotÃ¡.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La âârana toroââ en la Selva AtlÃ¡ntica Interior Argentina: un nuevo problema de conservaciÃ³n.'' Cuadernos de HerpetologÃa, 20, 37-40.
Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''IntroducciÃ³n de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
SÃ¡nchez, D., ChacÃ³n-Ortiz, A., LeÃ³n, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.

Source:

License: