Oryctolagus cuniculus

License:

Rights Holder:

NatureServe

Geographic Range

Oryctolagus cuniculus, also called a European, an Old World, or a domestic rabbit, is the only species in its genus. The last Ice Age confined the species to the Iberian peninsula and small areas of France and northwest Africa, but due to human action and adaptability of this species, European rabbits today exist in the wild on every continent except Asia and Antarctica. Domesticated O. cuniculus may be found worldwide.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

References:

Parker, S. 1990. Grzimek's Encyclopedia of Mammals. New York, NY: McGraw-Hill, Inc..
Wilson, D., D. Reeder. 1993. Mammal Species of the World: A Taxonomic and Geographic Reference. Washington, D.C: The Smithsonian Institution.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Range Description

Original distribution after last ice age included Iberian Peninsula (Spain and Portugal) to western France and northern Africa, and the introduction throughout western Europe is thought to have occurred as early as the Roman period (Gibb 1990, Mitchell-Jones et al. 1999).

Currently ranges through all Western European countries, Ireland and the UK (including islands), Austria, parts of Sweden, Poland, the Czech Republic, Hungary, Romania, Ukraine, and Mediterranean islands Sicily, Corsica, Sardinia, Crete, the Balearics (Thompson and King 1994), Croatia, and Slovakia (Mitchell-Jones et al. 1999). Introduced to Australia, in 1788 and again in 1859, where it is now widespread (Thompson and King 1994). Introduced to South America unsuccessfully several times since the mid-nineteenth century, successfully in about 1936 where it maintains limited range in Argentina and Chile (Thompson and King 1994). Found in many islands in the Pacific, off the African coast, New Zealand, and the Caribbean (Thompson and King 1994).

O. cuniculus is usually found below 1,500 m in elevation (Fa et al. 1999).

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

occurs (regularly, as a native taxon) in multiple nations

Source:

License:

Rights Holder:

NatureServe

Range

Rabbits originate from southwest Europe and north-west Africa, but they have been introduced to many countries including South Africa, Australia, New Zealand, and North and South America, for a range of reasons, not least the need for a ready supply of meat (3). Rabbits are at present widespread and common throughout Britain and Ireland (5).

Source:

License:

Rights Holder:

Wildscreen

Brief Summary

Every dune has its bunny! In reality, rabbits haven't been found in the Netherlands all that long. They were imported during the Middle Ages for their fur and meat. In 1950, rabbits were very common in Dutch dunes. But because they ate so much and dug holes, people were not thrilled with all those rabbits. They were hunted and combatted. However, when diseases such as myxomatosis and VHS practically decimated the population around 1990, nature managers suddenly realized how useful the rabbits could also be. They can keep grass short and thereby help to fight overgrowth in the dunes. Fortunately, rabbits are making a come back in many places.

Source:

Ecomare

License:

Rights Holder:

Biology

Rabbits tend to be active during the evening and night, but in areas where they are undisturbed by humans they become more active during the day (5). They feed on a wide range of vegetation, including grasses, tree bark, crops, and herbs (5). They live in groups numbering between a single pair and up to 30 individuals, inside burrow systems known as 'warrens' (4). Burrowing is carried out solely by females (3). Within a warren, two distinct hierarchies operate, one amongst bucks, the other amongst does; an individual's status is set during play-fighting as a young rabbit (3). Fighting may occur between two males over a receptive doe (3). Scent marking known as 'chinning', because the scent glands are located underneath the chin, is exhibited by both sexes but is more frequent in males than females. This behaviour reinforces the social ranking of an individual (3). Sexual maturity is reached at 3.5 months in does and 4 months of age in bucks, and breeding tends to occur between January and August. Courtship involves males chasing females, and spraying them with urine (3). Mating is a brief affair, lasting just a few seconds, but is repeated frequently while the female is receptive. Gestation takes about 30 days, and one litter is usually produced each month, each litter consisting of 2-7 blind, helpless and naked young (kittens), which are born in a nest lined with fur from the mother's belly (3). Foxes, mink, stoats, polecats, and wildcats prey upon all ages of rabbit; badgers, weasels, buzzards and domestic cats prey on juveniles (5). Rabbits are very alert mammals, with a keen sense of smell. When feeding, they periodically rear up on their back legs to look for danger; they warn other rabbits of danger by thumping their back legs on the ground and raising the white tail, signals that cause other rabbits to bolt back to the safety of the warren (3).

Source:

License:

Rights Holder:

Wildscreen

Description

One of our best-known wild mammals, the rabbit was introduced to Great Britain during the Twelfth century AD by the Normans (3). Its hopping gait (2), long mobile ears and short 'bob-tail' have endeared this species to children and adults alike, and domesticated rabbits are popular pets (3). The coat is normally greyish-brown, but can range from sandy yellow to totally black. The belly and underside of the tail are white (3). Rabbits are smaller than hares, and have comparatively shorter legs (3). Males (bucks) and females (does) are similar in appearance, but bucks tend to weigh more and have slightly broader heads (3).

Source:

License:

Rights Holder:

Wildscreen

Morphology

Physical Description

Wild O. cuniculus weigh between 1.5 and 2.5 kg, and are from 38 to 50 cm long. Domestic individuals may be larger. The coat is generally grayish, with black and brown (and sometimes red) sprinkled throughout. The underside of the body is paler gray, and the underside of the tail is white. Melanistic specimens are not unusual. (Macdonald, 1984)

This species (and rabbit species generally) have smaller ears and shorter, less powerful legs than their hares.

Oryctolagus cuniculus is the ancestor of all domestic rabbits (about 80 varieties!). Domesticated O. cuniculus vary tremendously in size, fur type, coloration, and general appearance. (Nowak, 1999)

Range mass: 1.5 to 2.5 kg.

Range length: 38 to 50 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Average basal metabolic rate: 7.395 W.

References:

Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File Publications.
Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The John's Hopkins University Press.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Size

Length: 60 cm

Weight: 2300 grams

Source:

License:

Rights Holder:

NatureServe

Habitat

Habitat and Ecology

Oryctolagus cuniculus prefers a mixed habitat of Mediterranean oak savanna or scrub-forest, or areas with around 40% cover for shelter from predators and open areas that support their diet of grasses and cereals (Thompson and King 1994; Ward 2005). O. cuniculus builds warrens in soft soil, but find shelter in scrub in rocky areas, though predation risk is higher in above ground dwellings. The natural range of the Iberian peninsula and northern Africa is warm and dry (Angulo 2003), rarely occurring above 1,500 m (Fa et al. 1999). The rabbits are territorial and tend to live and forage in colony groups of up to 20 adults (Mitchell-Jones et al. 1999), and are crepuscular (Ward 2005).

O. cuniculus can breed throughout the year (uncommon in lagomorphs), though this is limited by climate and resource availability (Bell and Webb 1991). They raise altricial young between three and six at a time, which leave the warren in under a month (Gibb 1990). Females reach sexual maturity on average in 3.5 months, males 4 months, and can live up to 9 years (Macdonald and Barrett 1993), though many succumb to predation and other perils much earlier. Up to 75% of young rabbits are killed by predators before they establish a territory (Chapman and Flux 1990, Angulo 2004). Annual mortality was 30% in a studied island population (Macdonald and Barrett 1993). The head-body length of O. cuniculus is 34-50 mm (Macdonald and Barrett 1993).

O. cuniculus is a keystone species, composing the diet of over forty species, several of which specialize in O. cuniculus (Delibes and Hiraldo 1981). The diet of the Iberian lynx consists of 80-100% rabbits (Delibes et al. 2000), the Imperial eagle consumes 40-80% of its diet in rabbits, and the decline of O. cuniculus has been linked to the near extinction of these two predators (Zofio and Vega 2000).

O. cuniculus is responsible for landscape modelling that supports vegetation growth typical to Spain and Portugal and creates habitat for invertebrate species (Virgos et al. 2005), increases species richness, and increase soil fertility (Willott et al. 2000).

Systems

Terrestrial

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Habitat

The preferred habitats of this species include dry areas near sea level with soft, sandy soil (for easy burrowing). Brushy fields are preferred for the cover they provide, but forests are also inhabited. Cultivated land was once well-suited, but this is no longer the case due to modern plowing techniques which destroy rabbit burrows. Particularly in central Europe, O. cuniculus has learned to coexist with humans in cities, making its home in parks and cemeteries as well as gardens and lawns. Human activities, particularly the spread of agriculture, have often inadvertently helped this species to colonize new areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: urban ; suburban ; agricultural

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Comments: Primarily found in short grasses, agricultural pastures, and scrub areas. Digs extensive burrow systems. Young are born in underground burrows in nests lined with vegetation and the mother's belly fur.

Source:

License:

Rights Holder:

NatureServe

Habitat

A highly adaptable species, rabbits tend to prefer areas where the soil is loose and free draining, with cover such as scrub or rocks. Favoured habitats include small fields of arable or pasture with hedgerows, as well as sand dunes. They tend to avoid coniferous woodlands, damp areas, and very rarely occur above the tree line (3).

Source:

License:

Rights Holder:

Wildscreen

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Source:

License:

Rights Holder:

NatureServe

Trophic Strategy

Food Habits

Oryctolagus cuniculus is a generalized herbivore, eating a diverse diet of grasses, leaves, buds, tree bark, and roots. Gardeners know them to eat lettuce, cabbage, root vegetables, and grains.

Although the diet is relatively low in nutritional value, and high in indigestible material, O. cuniculus is one of several rabbit species that are known to reingest feces (coprophagy) to obtain extra nourishment from their food. The species has a very large caecum, in which bacterial fermentation of otherwise indigestible material occurs. Periodically, the contents of the caecum are defecated and reingested. These rabbits are thought to depend upon this process for some essential nutrients, which are released or produced by bacteria and absorbed on this second pass through the digestive system. (Macdonald, 1984; Vaughan, 2000)

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: dung

Primary Diet: herbivore (Folivore )

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Comments: Grasses and other herbaceous plants. Also may eat bark and twigs of woody plants and agricultural crops.

Source:

License:

BioImages - the Virtual Fieldguide (UK)

Rights Holder:

NatureServe

Associations

Animal / carrion / dead animal feeder
gymnothecium of Actinodendron verticillatum feeds on dead bone of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Actinomucor elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Agrocybe pediades is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
larva of Aphodius brevis feeds on dung/debris usually part dried dung of Oryctolagus cuniculus
Other: major host/prey

Plant / resting place / within
imago of Aphodius coenosus may be found in dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium leporinum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium macrotheca is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Arnium mendax is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus boudieri is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus brassicae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious apothecium of Ascobolus ciliatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus crenulatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus degluptus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus mancus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus minutus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus stercorarius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary or gregarious apothecium of Ascodesmis microscopica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile, densely gregarious apothecium of Ascophanus bresadolae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus crouanii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus cunicularius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus parvisporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus subhirtus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Ascozonus woolhopensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea bombardioides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea serignanensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
erect, usually in small fascicles stroma of Bombardioidea stercoris is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Cephalotrichum dematiaceous anamorph of Cephalotrichum nanum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Cephalotrichum dematiaceous anamorph of Cephalotrichum purpureofuscum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnematum of Echinobotryum dematiaceous anamorph of Cephalotrichum stemonitis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / associate
sporangiophore of Chaetocladium brefeldii is associated with dung of Oryctolagus cuniculus

Animal / associate
sporangiophore of Chaetocladium jonesii is associated with dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Chaetomium atrobrunneum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium aureum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium bostrychodes is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium crispatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium elatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Chaetomium globosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium murorum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
perithecium of Chaetomium quadrangulatum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: unusual host/prey

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
sessile apothecium of Cheilymenia raripila is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite
Cheyletiella parasitivorax ectoparasitises body of Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Chorioptes cuniculi is ectoparasitoid of Oryctolagus cuniculus

Animal / parasite / endoparasite
tapeworm of Cittotaenia denticulata endoparasitises intestine of Oryctolagus cuniculus

Animal / parasite / endoparasite
tapeworm of Cittotaenia pectinata endoparasitises intestine of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta hansenii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta ligniaria is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta saccardoi is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Coniochaeta scatigena is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Coprinopsis filamentifer is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Coprinus sterquilinus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinus tuberosus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus albidus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus glaucellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus niveus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Coprotus rhyparobioides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Coprotus sexdecimsporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

In Great Britain and/or Ireland:
Animal / dung saprobe
fruitbody of Cyathus stercoreus is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia chaetomoides is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia consociata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia didyma is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia furfuracea is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia marchalii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia myriaspora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia niesslii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
pseudothecium of Delitschia winteri is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Plant / resting place / within
Diastictus vulneratus may be found in entrance to burrow of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
sporangiophore of Dispira cornuta is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / endoparasite
Eimeria stiedae endoparasitises very swollen, with large yellowish white areas of dead tissue liver of Oryctolagus cuniculus

Animal / dung associate
larva or puparium of Fannia manicata inhabits dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria hepatica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria leporum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Fimaria theioleuca is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / endoparasite
worm of Graphidium strigosum endoparasitises stomach of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Hebeloma radicosum is saprobic in/on dung or excretions of nest of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra brefeldii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra equorum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra merdaria is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
immersed perithecium of Hypocopra planispora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Iodophanus carneus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Oryctolagus cuniculus

Animal / dung saprobe
apothecial stroma of Lanzia cuniculi is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor genevensis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor mucedo is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Mucor racemosus f. sphaerosporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Mycocalia denudata is saprobic in/on dung or excretions of wet, weathered dung of Oryctolagus cuniculus

Animal / dung saprobe
fruitbody of Mycocalia duriaeana is saprobic in/on dung or excretions of weathered dung of Oryctolagus cuniculus

Animal / pathogen
Myxoma virus infects Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Notoedres is ectoparasitoid of crusty manged eye of Oryctolagus cuniculus

Animal / parasite / ectoparasite
Notoedres cati ectoparasitises ear, then rest of body of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
colony of Onychophora anamorph of Onychophora coprophila is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Fungus / feeder
Oryctolagus cuniculus feeds on subterranean ascoma of Elaphomyces granulatus

Animal / parasite / endoparasite
Passalurus ambiguus endoparasitises caecum of Oryctolagus cuniculus

Animal / dung saprobe
coremium of Penicillium dematiaceous anamorph of Penicillium claviforme is saprobic in/on dung or excretions of dung Oryctolagus cuniculus

Animal / dung saprobe
sessile apothecium of Peziza bovina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
substipitate or sessile apothecium of Peziza fimeti is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
colony of Oedocephalum anamorph of Peziza vesiculosa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary or clustered, sessile apothecium of Pezizella albula is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilaira anomala is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilaira moreaui is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. crystallinus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. kleinii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung associate
sporangiophore of Piptocephalis cylindrospora inhabits dung of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Piptocephalis freseniana is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Piptocephalis lepidula is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
Podops inuncta feeds on dung/debris dung of Oryctolagus cuniculus
Remarks: Other: uncertain

Animal / dung saprobe
long rooted, perithecial stroma of Podosordaria leporina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
long rooted, perithecial perithecium of Podosordaria tulasnei is saprobic in/on dung or excretions of buried dung of Oryctolagus cuniculus
Remarks: captive: in captivity, culture, or experimentally induced

Animal / dung saprobe
superficial perithecium of Podospora appendiculata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora collapsa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora communis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
immersed, neck protruding perithecium of Podospora curvicolla is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora decipiens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus
Other: minor host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora granulostriata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora gwynne-vaughaniae is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora perplexens is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora pleiospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
stalked stroma of Poronia erici is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung associate
larva of Potamia littoralis inhabits dung of Oryctolagus cuniculus

Virus / infection vector
Potato Mosaic virus X is spread by Oryctolagus cuniculus

Animal / parasitoid / ectoparasitoid
Psoroptes communis is ectoparasitoid of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Pyxidiophora petchii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered, often immersed apothecium of Ryparobius dubius var. dubius is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious, partly immersed apothecium of Ryparobius pachyascus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
solitary, superficial, sessile apothecium of Saccobolus caesariatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus dilutellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered, superficial, sessile apothecium of Saccobolus globuliferellus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious, superficial, sessile apothecium of Saccobolus obscurus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus versicolor is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite
burrowing mite of Sarcoptes scabei ectoparasitises lesioned face of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium glutinans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium nanum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium pilosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium squamulosum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
perithecium of Schizothecium tetrasporum is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung/debris feeder
gymnothecium of Shanorella spirotricha feeds on dung/debris fur of Oryctolagus cuniculus

Animal / dung saprobe
gregarious perithecium of Sordaria fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly grouped perithecium of Sordaria humana is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
grouped perithecium of Sordaria macrospora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered perithecium of Sordaria polyspora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
grouped perithecium of Sordaria superba is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
partly immersed perithecium of Sphaeronaemella fimicola is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / parasite / ectoparasite / blood sucker
adult of Spilopsyllus cuniculi sucks the blood of young of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella antarctica is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella bipartis is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella corynespora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella heptamera is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella intermedia is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella leporina is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella octomera is saprobic in/on dung or excretions of old dung of Oryctolagus cuniculus

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pulchella is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
synnema of Stilbella anamorph of Stilbella erythrocephala is saprobic in/on dung or excretions of old dung of Oryctolagus cuniculus
Other: major host/prey

Animal / parasite / endoparasite
Cysticercus larva of Taenia pisiformis endoparasitises liver of Oryctolagus cuniculus

Animal / parasite / endoparasite
Coenurus larva of Taenia serialis endoparasitises muscle of Oryctolagus cuniculus

Animal / dung saprobe
sporangiophore of Thamnidium elegans is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
gregarious apothecium of Thelebolus microsporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
apothecium of Thelebolus nanus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
scattered or gregarious, sessile apothecium of Thelebolus polysporus is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / dung saprobe
cleistothecium of Thielavia wareingii is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Animal / associate
fruitbody of Trechispora clancularis is associated with disused burrow of Oryctolagus cuniculus

Animal / parasite / endoparasite
worm of Trichostrongylus retortaeformis endoparasitises ilium (anterior part) of Oryctolagus cuniculus

Animal / associate
imago of Typhaeus typhoeus is associated with dung of Oryctolagus cuniculus

Animal / dung saprobe
superficial, stromatal perithecium of Wawelia octospora is saprobic in/on dung or excretions of incubated dung of Oryctolagus cuniculus
Remarks: captive: in captivity, culture, or experimentally induced

Animal / dung saprobe
scattered, superficial cleistothecium of Zopfiella erostrata is saprobic in/on dung or excretions of dung of Oryctolagus cuniculus

Source:

License:

Rights Holder:

BioImages

Predation

Rabbits are preyed upon by a wide variety of carnivores, including canines, felines, mustelids, hawks and owls.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

General Ecology

Gregarious. "Warrens" (extensive burrow systems with many entrances) may occupy an area of more than 1 hectare. Predators include domestic cats, foxes, weasels, etc.

Source:

License:

Rights Holder:

NatureServe

Behavior

Communication and Perception

Oryctolagus cuniculus is generally nocturnal, spending its days underground and foraging from evening until morning. Though generally silent, rabbits are capable of making loud screams when frightened or injured. They communicate with each other through scent cues and touch, and thump their hindlimbs on the ground to warn of danger. (Nowak, 1999; Parker, 1990)

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: vibrations

Perception Channels: visual ; infrared/heat ; acoustic ; vibrations

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Cyclicity

Comments: Active throughout the year.

Source:

License:

Rights Holder:

NatureServe

Life Expectancy

Lifespan/Longevity

Domestic rabbits can live to be up to nine years old. However, mortality during the first year of life in wild populations is generally quite high, and can reach as much as 90%.

Average lifespan
Status: wild: 9 years.

Average lifespan
Status: captivity: 9 years.

Typical lifespan
Status: wild: 1 (high) years.

Average lifespan
Status: wild: less than 1 years.

Source:

License:

http://creativecommons.org/licenses/by/3.0/

Rights Holder:

The Regents of the University of Michigan and its licensors

Lifespan, longevity, and ageing

Maximum longevity: 9 years Observations: Although in the wild females reach full sexual maturity at the age of 2 years, in domesticated animals females can reproduce when they are only three months old. There are many anecdotes concerning the longevity of rabbits. It has been estimated that both in the wild and in captivity they rarely live more than 9 years (Ronald Nowak 1999). A rabbit in Australia called "Flopsy" reportedly lived 18.8 years in captivity after being caught in the wild (http://www.guinnessworldrecords.com/), but this record cannot be confirmed. Record longevity in zoos and parks is only 7.9 years belonging to one female at Frankfurt Zoo (Richard Weigl 2005). Further studies are necessary to better estimate the maximum longevity of these animals.

Source:

AnAge

License:

Rights Holder:

Joao Pedro de Magalhaes

Reproduction

Mating in rabbits is generally polygynandrous, though males will attempt to monopolize particular females.

Mating System: polygynandrous (promiscuous)

Rabbits are well-known for their reproductive capacity. Oryctolagus cuniculus is capable of reproducing year-round, but most breeding activity takes place in the first half of the year. Gestation is about 30 days, and the average litter contains 5 to 6 young. Females experience postpartum estrus and thus may have several litters per year, though spontaneous abortions and resorption of embryos are common (possibly due to environmental or social stresses). (Vaughan, 2000; Nowak, 1999)

One reason for the reproductive success of rabbits is induced ovulation, where eggs are only released in response to copulation. (Macdonald, 1984) Rabbit placentae allow an unusually high degree of contact between maternal and fetal bloodstreams, a condition they share with humans. Thus, they are useful models for the study of human pregnancy and fetal development. (Banks, 1989)

Neonates, called kittens, are naked, blind and helpless. The mother visits the nest for only a few minutes each day to nurse them, but the milk is extremely rich. Young are weaned at four weeks of age, attain sexual maturity at about eight months, and can live up to nine years old. However, mortality rates in the first year of life frequently exceed 90%. (Nowak, 1999; Macdonald, 1984)

Breeding interval: Breeding may occur approximately monthly.

Breeding season: These animals breed throughout the year, although most breeding takes place in the first half of the year.

Range number of offspring: 1 to 14.

Average number of offspring: 6.

Range gestation period: 30 to 37 days.

Average gestation period: 30 days.

Range weaning age: 22 to 31 days.

Average weaning age: 28 days.

Average time to independence: 4 weeks.

Average age at sexual or reproductive maturity (female): 8 months.

Average age at sexual or reproductive maturity (male): 8 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous ; post-partum estrous

Average birth mass: 45 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (female)
Sex: female: 730 days.

Females provide maternal care to their altricial young. Males are not involved in caring for young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

References:

Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File Publications.
Vaughan, T., J. Ryan, N. Czaplewski. 2000. Mammology. New York, NY: Harcourt, Inc..
Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The John's Hopkins University Press.
Banks, R. 1989. "Rabbits: Models and Research Applications (USAMRIID Seminar Series)" (On-line). Accessed November 29, 1999 at http://netvet.wustl.edu/species/rabbits/rabtmodl.txt.

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Main part of mating season occurs January-June. Gestation lasts 28-33 days. Females give birth to 3-9 young; as many as 6 litters per year. On island in Hawaii, productivity is low: average of 6.6 young/adult female/year (Dixon 1973).

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

NatureServe

Molecular Biology

Barcode data: Oryctolagus cuniculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTTTTCTCTACCAACCACAAAGACATCGGCACTCTTTATCTCCTATTTGGAGCTTGAGCTGGGATGGTGGGAACAGCCCTCAGCCTGCTAATTCGAGCAGAATTAGGTCAGCCAGGGACTCTACTCGGGGAT---GATCAAATCTATAATGTAATCGTCACCGCACATGCCTTTGTAATAATCTTCTTTATAGTCATGCCTATTATAATTGGAGGCTTCGGGAACTGGCTTGTCCCCCTGATAATTGGGGCTCCTGACATAGCCTTCCCCCGAATAAATAATATGAGCTTCTGACTTCTCCCCCCTTCATTCCTTCTTCTACTAGCCTCCTCAATAGTAGAAGCTGGGGCGGGGACTGGCTGAACTGTTTATCCACCTCTAGCCGGTAATCTTGCACATGCTGGAGCCTCAGTGGATCTTACTATTTTCTCCCTTCACTTAGCTGGAGTATCATCTATTTTAGGGGCTATTAACTTTATTACAACTATTATTAATATGAAAGCCCCTGCAATATCTCAATATCAAACCCCCTTATTCGTATGATCTGTTCTAATCACAGCCGTACTTCTTCTTCTCTCTTTACCAGTCCTAGCTGCTGGCATTACAATGCTTTTAACAGACCGAAACTTAAATACAACCTTCTTTGATCCTGCAGGAGGAGGAGACCCTATCCTCTACCAACACCTATTCTGATTTTTCGGGCACCCCGAAGTATATATTCTTATTCTTCCAGGATTTGGAATAATTTCGCACATTGTGACATACTATTCCGGGAAAAAAGAGCCATTTGGCTATATAGGAATAGTATGAGCTATAATATCAATTGGTTTCCTTGGATTTATCGTATGGGCCCATCATATATTTACAGTAGGAATAGATGTAGACACACGAG
-- end --

Download FASTA File

Source:

License:

http://creativecommons.org/licenses/by/3.0/

Rights Holder:

Barcode of Life Data Systems

Statistics of barcoding coverage: Oryctolagus cuniculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 17
Species With Barcodes: 1

Source:

Barcode of Life Data Systems (BOLD)

License:

http://creativecommons.org/licenses/by/3.0/

Rights Holder:

Barcode of Life Data Systems

Conservation Status

IUCN Red List Assessment

Red List Category

Near Threatened

Red List Criteria

Version

3.1

Year Assessed

2008

Assessor/s

Smith, A.T. & Boyer, A.F.

Reviewer/s

Ward, D. & Johnston, C.H. (Lagomorph Red List Authority)

Contributor/s

Justification

Oryctolagus cuniculus is a widespread colonizer and is considered a pest outside its natural range, where eradication of the rabbit is priority for conservation (Thompson and King 1994). However, only the natural range of Spain, Portugal, and northwestern Africa (Morocco and Algeria) are considered in this global assessment.

O. cuniculus populations within the natural range have declined an estimated 95% since 1950, and 80% in Spain since 1975 (Delibes et al. 2000), due to disease, habitat loss, and human induced mortality (Ward 2005). These numbers are based on estimates from a protected area in Spain, Donana National Park, and the relative decline elsewhere in the range (Delibes et al. 2000). O. cuniculus nearly meets the Red List Criteria for Vulnerable under A2acde. There is no evidence that the decline has escalated in recent years, though threats remain and the decline is continuing.

History

1996

Lower Risk/least concern

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Conservation Status

Few mammal species are farther from extinction than O. cuniculus. Not only is it valuable to humans as a domestic and game animal, but wild populations have established themselves successfully in many parts of the world. However, one variety of O. cuniculus found on islands in the Atlantic and Mediterranean may be at risk. (Wilson & Reeder, 1993)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Source:

License:

Rights Holder:

NatureServe

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Source:

License:

Rights Holder:

NatureServe

Status

Not legally protected in Great Britain (4).

Source:

License:

Rights Holder:

Wildscreen

Trends

Population

Oryctolagus cuniculus decline has escalated in recent years. In Spain the rabbit has declined to 20% of the population size from 1975 (Virgos et al. 2005). As of 2005, rabbit populations in the Iberian peninsula have declined to as little as 5% of the number from 1950, based on the decrease in Donana National Park, a protected area (Delibes et al. 2000). Density of rabbits has been recorded at a maximum of 40 per hectare in prime habitat, though the abundance has declined significantly since the arrival of new threats in the mid 20th century (Angulo 2004).

In Portugal, a population reduction of 24% was recorded between 1995 and 2002 (Alves and Ferreira 2002).

Decline has been uneven across the range, due to varying degrees of threat (Ward 2005).

Population Trend

Decreasing

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Threats

Major Threats

The greatest force behind the decline of Oryctolagus cuniculus has been two diseases that appeared in the 20th century. Myxomatosis is a South American virus, primarily spread by insect (mosquito and flea) vectors, that was intentionally introduced by a farmer in the mid 1950s in France to control the rabbit population (Angulo and Cooke 2002). An estimated 90% of European rabbits have perished due to myxomatosis since the 1950s (Virgos et al. 2005). After symptom onset, death results in an average of 13 days (Ward 2005). Rabbits with the virus are made more vulnerable to predators (Villafuerte et al. 1995). Juveniles are more susceptible to myxomatosis than adults. Myxomatosis cases peak during early summer to fall (Angulo 2004).

Rabbit Haemorrhagic Disease (RHD) is a virus that appeared in Europe in the late 1980’s, initially causing the death of 55-75% of rabbits in the Iberian peninsula (Villafuerte et al. 1995). RHD is primarily spread by direct contact. Death typically results within 24 hours of symptom onset, with a short incubation time of under 48 hours (Villafuerte et al. 1995). Adult rabbits are more susceptible to RHD than juveniles (unlike myxomatosis), and RHD is more prevalent in late winter and spring (Angulo 2004). Global warming may increase disease incidence by creating a warmer, drier climate in Spain and Portugal (Ward 2005).

Habitat loss and fragmentation are continuing causes of decline for O. cuniculus, which requires scrub-forest vegetation for food and shelter (Ward 2005). Modern intensive agriculture negatively impacts rabbits more than small scale mixed farming, which may have initially increased suitable habitat within the rabbit’s natural range (Delibes et al. 2000). High intensity livestock production contributes to habitat degradation and resource competition. Fallow farm land often returns to closed forest rather than scrub, which is not a suitable habitat (Ward 2005). Tree plantations planted in Spain and Portugal have replaced habitat for both rabbits and their predators and urbanization presents a threat as does increased fire danger in existing habitat, and climate change (Ward 2005).

Exploitation of O. cuniculus by humans has recently become a threat, especially as the populations are already declining due to other causes, so rabbits cannot sustain hunting and control measures as well as in the past. Farmers control rabbit populations directly by poisoning, trapping, and destroying warrens. They indirectly cause decline through habitat conversion and excessive pesticide and fertilizer use. Hunting presents a threat to rabbit populations, compounded by their existing decline from disease, possibly eliminating many rabbits that have acquired resistance to the diseases (Delibes et al. 2000). 70% of Spain is designated as hunting area. Hunter registration doubled between 1960 and 2005 (Angulo 2003), though the overall catch is declining, probably due to shrinking rabbit abundance (Ward 2005).

Future threats to the European rabbit may include a genetically modified version of the myxomatosis virus being developed in Australia to suppress rabbit fertility where the European rabbit has been introduced (ABC 2003). Unlicensed release of the modified virus to the native range could devastate the remaining populations (Ward 2005).

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Threats

In 1953 the Myxoma virus killed a massive 99% of the British rabbit population (5). A level of resistance is now apparent (4), and although the virus is still present in the population, the mortality caused has fallen substantially (5). Rabbit haemorrhagic disease (RHD) was first identified in British rabbits in 1994, and the combined effect of myxomatosis (the disease caused by the Myxoma virus) and RHD is as yet unknown (5). Rabbits are serious agricultural pests and their populations are controlled by shooting, trapping and exclusion in many areas. They can pose serious threats to sensitive habitats, yet conversely, rabbit grazing is essential for the maintenance of other threatened habitats such as calcareous grasslands (5).

Source:

License:

Rights Holder:

Wildscreen

Management

Conservation Actions

Conservation for Oryctolagus cuniculus was delayed for several decades after their decline became apparent. Efforts began to take shape in the late 1980's due to previous political isolation of its native range and the lack of information on the species as a keystone to Iberian ecosystems. The issue of eradication of O. cuniculus from introduced areas (e.g. Australia, New Zealand, and many islands) may have diminished the appearance of rabbit decline in its native range. Increased interest in the specialist predators that depend upon the rabbits and the issue of the sustainability of hunting populations have brought O. cuniculus into the public eye, but fail to address some issues of rabbit conservation, such as its role as an ecosystem modeler and the effects of agriculture on populations (Gibb 1990, Ward 2005).

Oryctolagus cuniculus occurs in some protected areas within its natural range, including Donana National Park in Spain (Ward 2005) and Serra da Malcata Nature reserve in Portugal (700 km²) where the Iberian lynx is protected.

Dan Ward's 2005 report outlines specific goals needed to achieve rabbit recovery:
- Establish rabbit monitoring programs to accurately describe decline directly.
- Create and implement a management plan for rabbit recovery that prioritizes critical ranges and populations. Some plans have begun for local regions, including Donana National park.
- Programs to limit the incidence and impact of new and existing diseases may be difficult in the wild, though some success has been observed in captive populations. Current vaccines do not confer total immunity to RHD or myxomatosis, have side effects such as increasing vulnerability to predators, and have short-lived effectiveness. A genetically modified live myxomatosis virus vaccine, LapinVac, is controversial because of the possibility of unpredictable evolution of the virus, and its potential spread to rabbit populations outside the natural O. cuniculus range where eradication, not conservation, is the objective. Increasing habitat quality may indirectly help rabbit disease resistance. Controlling disease vectors for myxomatosis has not been found to be effective. Preventing the spread of modified immunocontraceptive viruses engineered in Australia to control rabbit fertility may become an issue.
- Reducing hunting impact is not guaranteed to reduce decline because disease effects often outweigh hunting as a threat, and because implementation of restrictions would likely not be realistic given the prevalence of hunting in Iberia. Revisions to existing hunting seasons have been proposed and some tested, but even moving the season to summer when rabbits are most abundant has caused concern in trials because the overall catch increases and the season coincides with a peak in death from disease. A growing recognition among hunters of the issue of rabbit decline has led to some self-restraint, and though often well intentioned, uninformed management strategies are leading to inappropriate actions. Rather than focusing on hunting restraint, many hunters exert efforts to reduce rabbit predators, which are not directly responsible for decline. As a very large demographic, hunters could represent a powerful force in maintaining sustainable hunting populations, if the awareness of the issue of decline increased within this group.
- Rabbit populations affected by agriculture represent a sensitive issue, as rabbits are typically seen as a pest and an economic liability for farmers. Despite pressures from environmental groups, many farmers continue to take measures to eradicate rabbits from their land, even in areas where rabbit populations have declined dramatically. Awareness among farmers of rabbit conservation issues is low. Government policy allows farmers to control rabbits with permits, and though crop loss due to rabbit damage is economically subsidized, no requirement of those compensated is made for conservation.
- Halting and reversing habitat loss and fragmentation was aided in the 1990s by the establishment of many national parks in Spain, but much optimal rabbit habitat is on private land. A shift from high-intensity farming and monoculture forestry back to mixed agro-forestry and small scale farming would help sustain rabbit populations. Natura 2000 promotion of sustainable development and EU subsidies supporting environmentally friendly agriculture are promising but underfunded and too new to demonstrate a significant impact. Eucalyptus plantation removal has demonstrated a positive effect on rabbit populations, but may compromise other environmental issues such as erosion and conditioned bird habitat, as well as economic impact.
- Reintroductions have been a key focus of conservation efforts, with up to 500,000 released annually in Spain and France. The efforts so far have not increased rabbit populations, due to increased mortality from predation and inadvertent spread of disease, which may actually have a net negative impact. The flaws in reintroduction practices do not completely negate the importance of the efforts, which have been shown to help sustain predators and hunting populations. The success of reintroductions may be increased by fencing from predators and competitors and preventing dispersal.
- Though rabbit predators have not directly caused rabbit decline, factors that have caused initial decline (e.g. disease, habitat loss) are exacerbated by some opportunistic predators (while not caused by specialist predators like the Iberian lynx and Imperial eagle). Game keeping efforts to increase rabbit populations often focus on predator reduction, sometimes counter productively, causing decline of top predators that are already threatened. Efforts could be more productively focused on habitat protection, reduction of rabbit mortality by humans (hunting and poisoning), and reducing disease impacts.

The importance of O. cuniculus within its natural range requires that it be considered for listing in spite of its global abundance. It is a keystone to the Iberian ecosystem, as prey for specialist predators (Virgos et al. 2005) and as a landscape modeler (Delibes et al. 2000, Ward 2005). It is an important game species in Spain and Portugal (Ward 2005).

Source:

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Conservation

Rabbits are not legally protected in Great Britain (4). Following the crash in rabbit numbers caused by myxomatosis, many species dependent on rabbit grazing for the maintenance of their habitats, such as the large blue butterfly (Maculinea arion) suffered greatly (4).

Source:

License:

Rights Holder:

Wildscreen

Benefits

Economic Importance for Humans: Negative

Oryctolagus cuniculus has been highly successful in most places where it has been introduced, and it is considered an agricultural pest in many areas (especially where its natural predators have been eliminated). These animals eat cultivated crops and compete with domestic animals for forage. Millions of dollars are spent annually in countries such as Australia, New Zealand, Britain, and the United States in efforts to control, confine or exterminate them. Additionally, rabbits have inflicted enormous ecological damage in some areas where they have been introduced.

Negative Impacts: crop pest; causes or carries domestic animal disease

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Economic Importance for Humans: Positive

Old World rabbits represent one of the most economically important mammal species. Wild O. cuniculus is a popular game animal, especially in Europe. Varieties of this speces are raised commercially for meat, skins and wool, and are popular as pets. These rabbits are used extensively (.5 million/year) in medical research and for testing the safety of chemicals and consumer products. (Nowak, 1999; Banks, 1989)

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education

Source:

License:

Rights Holder:

The Regents of the University of Michigan and its licensors

Risks

Species Impact: Introduced populations are capable of devegetating island ecosystems (see Warner 1963 and Tomich 1986 for review of status and destructive effects in Hawaii). Introduced island populations may interfere with seabird nesting (Brown 1974).

Source:

License: